D10Mit267 Primer Detail MGI Mouse MGI:704380

D10Mit267 Primer Detail

Name

D10Mit267
Primer 1 Sequence

ACACTTACAGTACCCTGGTGTGG
Primer 2 Sequence

GTGTGTGGGCGGATGTAAG
ID

MGI:704380
Product Size

103
Other IDs

D10Mit267 (BROAD)
Note

MIT assay: MTH2006
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 10, Massachusetts Institute of Technology 267

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D10Mit267	b	smaller than f	C57BL/6J
	c	100bp	C3HeB/FeJLe
	f	larger than c and b	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit267	a	94bp	A/J, BALB/cJ, DBA/2J
	b	100bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	c	104bp	CAST/EiJ
	d	116bp	SPRET/EiJ
	e	126bp	LP/J, NOD/MrkTac, NON/ShiLt
	f	136bp	AKR/J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit267	c	lower	CBA/Kw
	D10Mit267	k	upper	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24