D5Mit138 Primer Detail MGI Mouse MGI:704389

D5Mit138 Primer Detail

Name

D5Mit138
Primer 1 Sequence

AGACAGTTACCTTCTTCCCAAGG
Primer 2 Sequence

TGTTTCTCCCTTCTGCCATC
ID

MGI:704389
Product Size

147
Other IDs

D5Mit138 (BROAD)
Note

MIT assay: MT143
Additional information: MIT STS Marker Data Files

D5Mit138

DNA segment, Chr 5, Massachusetts Institute of Technology 138

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit138	a	116bp	AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
	b	118bp	SPRET/EiJ
	c	140bp	A/J, BALB/cJ, LP/J, NON/ShiLt
	d	142bp	CAST/EiJ
	e	146bp	B6.Cg-Lep^ob/+, C57BL/6J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D5Mit138	b	148bp	C57BL/6JOlaHsd, C57BL/10
	c	142bp	129P3/J, A/JOlaHsd, BALB/cJ, SJL/J
	d	120bp	AKR/OlaHsd, C3H/HeJ, DBA/2J
	j	136bp	JF1
	p	124bp	PWB

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit138	c	126bp	CBA/CaOlaHsd
	D5Mit138	s	130bp	SWR/OlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24