D1Mit215 Primer Detail MGI Mouse MGI:704420

D1Mit215 Primer Detail

Name

D1Mit215
Primer 1 Sequence

GGAGCAGAGTGTGAGAAGGG
Primer 2 Sequence

CCAGTGTGAGCCCATTCC
ID

MGI:704420
Product Size

149
Other IDs

D1Mit215 (BROAD)
Note

MIT assay: MT1279
Additional information: MIT STS Marker Data Files

D1Mit215

DNA segment, Chr 1, Massachusetts Institute of Technology 215

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit215	a	135bp	SPRET/EiJ
	b	139bp	AKR/J, LP/J
	c	149bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	d	151bp	NON/ShiLt
	e	155bp	CAST/EiJ
	f	157bp	A/J, BALB/cJ, C3H/HeJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit215	c	upper	CBA/Kw
	D1Mit215	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24