D1Mit362 Primer Detail MGI Mouse MGI:704467

D1Mit362 Primer Detail

Name

D1Mit362
Primer 1 Sequence

TGTGTGACTGCTTGGAAGATG
Primer 2 Sequence

CTGAGTCCCTAAAGTTGTCCTTG
ID

MGI:704467
Product Size

115
Other IDs

D1Mit362 (BROAD)
Note

MIT assay: MTAR4060
Additional information: MIT STS Marker Data Files

D1Mit362

DNA segment, Chr 1, Massachusetts Institute of Technology 362

J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit362	a	148bp	129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		c	122, 148bp	129S/SvEv
		d	116bp	129P1/ReJ, 129P2/Ola, 129P4/RrRkJ
		e	146bp	129X1/SvJ
		f	120bp	C57BL/6J
		g	140bp	C3HeB/FeJ

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit362	a	148bp	129X1/Sv
Not Specified	D1Mit362	b	116bp	129P2/Ola, CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit362	c	148bp	C3HeB/FeJLe
	D1Mit362	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit362	a	104bp	LP/J
	b	118bp	BALB/cJ, NON/ShiLt
	c	120bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	122bp	DBA/2J
	e	124bp	CAST/EiJ
	f	148bp	A/J, AKR/J, C3H/HeJ, NOD/MrkTac
	g	184bp	SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D1Mit362	c	not given	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit362	c	148bp	CBA/CaOlaHsd
	D1Mit362	s	113bp	SWR/OlaHsd

J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24