D1Mit365 Primer Detail MGI Mouse MGI:704474

D1Mit365 Primer Detail

Name

D1Mit365
Primer 1 Sequence

ATCACCTGCAATAGTACCCCC
Primer 2 Sequence

TTAATCAGTCATCATAGGCTTTTCC
ID

MGI:704474
Product Size

99
Other IDs

D1Mit365 (BROAD)
Note

MIT assay: MT3651
Additional information: MIT STS Marker Data Files

D1Mit365

DNA segment, Chr 1, Massachusetts Institute of Technology 365

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit365	a	92bp	CAST/EiJ
	b	98bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
	c	110bp	BALB/cJ, DBA/2J, NOD/MrkTac

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit365	c	147bp	CBA
	D1Mit365	s	157bp	SWR

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit365	a	110bp	BALB/cW, CBA/W, DBA/2W
	D1Mit365	b	98bp	129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24