About   Help   FAQ
D15Mit154 Primer Detail
Primers
  • Name
    D15Mit154
  • Primer 1 Sequence
    AGCACTGGGTACACAAACTGG
  • Primer 2 Sequence
    ATGAAAGCATGTGTAGTCTTTCTCA
  • ID
    MGI:704528
  • Product Size
    150
  • Other IDs
    D15Mit154 (BROAD)
  • Note
    MIT assay: MT2211
    Additional information: MIT STS Marker Data Files
Genes
D15Mit154 DNA segment, Chr 15, Massachusetts Institute of Technology 154
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit154 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit154 a 153bp SPRET/EiJ
b 165bp AKR/J, NON/ShiLt
c 169bp C3H/HeJ, LP/J
d 179bp CAST/EiJ, DBA/2J, NOD/MrkTac
e 190bp B6.Cg-Lepob/+
f 193bp A/J, C57BL/6J
g 198bp BALB/cJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory