D5Mit200 Primer Detail MGI Mouse MGI:704535

D5Mit200 Primer Detail

Name

D5Mit200
Primer 1 Sequence

CACAGAGAAGAATCTGCGAGC
Primer 2 Sequence

TTGCAAAGTGTTTTAATCAGTATTTG
ID

MGI:704535
Product Size

108
Other IDs

D5Mit200 (BROAD)
Note

MIT assay: MT2115
Additional information: MIT STS Marker Data Files

D5Mit200

DNA segment, Chr 5, Massachusetts Institute of Technology 200

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit200	a	108bp	129X1/Sv
Not Specified	D5Mit200	f	105, 108bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit200	a	93bp	CAST/EiJ
	b	97bp	SPRET/EiJ
	c	101bp	BALB/cJ
	d	105bp	C3H/HeJ, DBA/2J
	e	106bp	LP/J
	f	107bp	B6.Cg-Lep^ob/+, C57BL/6J
	g	108bp	AKR/J, NOD/MrkTac, NON/ShiLt
	h	109bp	A/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit200	c	100bp	CBA/CaOlaHsd
	D5Mit200	s	114bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24