D9Mit48 Primer Detail MGI Mouse MGI:704570

D9Mit48 Primer Detail

Name

D9Mit48
Primer 1 Sequence

ACTTGACATTTGCCCAGGTC
Primer 2 Sequence

CAGATCAGCTTGTGCGCTAG
ID

MGI:704570
Product Size

158
Other IDs

D9Mit48 (BROAD)
Note

MIT assay: B513
Additional information: MIT STS Marker Data Files

D9Mit48

DNA segment, Chr 9, Massachusetts Institute of Technology 48

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit48	a	118bp	LP/J
	b	122bp	A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
	c	146bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D9Mit48	a	160bp	BALB/cW, BN/aW, C57BL/6W, C57BL/10W
	b	146bp	A.CA/W, AKR/W, C3H/W, CBA/W, DBA/2W
	c	130bp	129/SvW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24