D9Mit43 Primer Detail MGI Mouse MGI:704573

D9Mit43 Primer Detail

Name

D9Mit43
Primer 1 Sequence

CAGTACAGCATTTACCACACAGC
Primer 2 Sequence

CCCCATGTTATTTCCTGGG
ID

MGI:704573
Product Size

132
Other IDs

D9Mit43 (BROAD)
Note

MIT assay: B366
Additional information: MIT STS Marker Data Files

D9Mit43

DNA segment, Chr 9, Massachusetts Institute of Technology 43

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit43	c	136bp	C3HeB/FeJLe
	D9Mit43	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit43	a	126bp	SPRET/EiJ
	b	128bp	AKR/J
	c	136bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	d	146bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24