D9Mit45 Primer Detail MGI Mouse MGI:704576

D9Mit45 Primer Detail

Name

D9Mit45
Primer 1 Sequence

CATAGTAGTGTGGGTTCTGTGAGC
Primer 2 Sequence

TCAATCCTCAGACACCCACA
ID

MGI:704576
Product Size

189
Other IDs

D9Mit45 (BROAD)
Note

MIT assay: J17
Additional information: MIT STS Marker Data Files

D9Mit45

DNA segment, Chr 9, Massachusetts Institute of Technology 45

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit45	c	larger	C3HeB/FeJLe
	D9Mit45	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit45	a	184bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	186bp	AKR/J, DBA/2J, LP/J
	c	188bp	SPRET/EiJ
	d	194bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24