D11Mit263 Primer Detail MGI Mouse MGI:704581

D11Mit263 Primer Detail

Name

D11Mit263
Primer 1 Sequence

GAAACCATTTTAAAATATACAGTTCGG
Primer 2 Sequence

CCAGGGTTAGGTAGGTATGGC
ID

MGI:704581
Product Size

145
Note

MIT assay: MT3587

DNA segment, Chr 11, Massachusetts Institute of Technology 263

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit263	a	130bp	CAST/EiJ
	b	144bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	c	148bp	AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
	d	150bp	DBA/2J, SPRET/EiJ
	e	156bp	A/J, C3H/HeJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D11Mit263	a	160bp	129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, JF1
	b	144bp	C57BL/6JOlaHsd
	c	148bp	BALB/cJ, SJL/J
	d	152bp	DBA/2J, PWB
	r	150bp	C57BL/10

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24