About   Help   FAQ
D8Mit224 Primer Detail
Primers
  • Name
    D8Mit224
  • Primer 1 Sequence
    ACGTCCCCAGTGCTTAACAC
  • Primer 2 Sequence
    TGGTGTAGCATAAAGCATATGTCC
  • ID
    MGI:704614
  • Product Size
    326
  • Other IDs
    D8Mit224 (BROAD)
  • Note
    MIT assay: MT3689
    Additional information: MIT STS Marker Data Files
Genes
D8Mit224 DNA segment, Chr 8, Massachusetts Institute of Technology 224
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit224 a 326bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
b 425bp LP/J
c 517bp A/J, AKR/J, BALB/cJ, NOD/MrkTac
d 523bp CAST/EiJ
e 527bp SPRET/EiJ
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit224 a smaller 129P3/J
s larger SJL/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D8Mit224 a 454bp A.CA/W, AKR/W, BALB/cW, BN/aW, CBA/W
b 430bpb 129/SvW
c 326bp C3H/W, C57BL/6W, C57BL/10W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory