D8Mit224 Primer Detail MGI Mouse MGI:704614

D8Mit224 Primer Detail

Name

D8Mit224
Primer 1 Sequence

ACGTCCCCAGTGCTTAACAC
Primer 2 Sequence

TGGTGTAGCATAAAGCATATGTCC
ID

MGI:704614
Product Size

326
Other IDs

D8Mit224 (BROAD)
Note

MIT assay: MT3689
Additional information: MIT STS Marker Data Files

D8Mit224

DNA segment, Chr 8, Massachusetts Institute of Technology 224

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit224	a	326bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	b	425bp	LP/J
	c	517bp	A/J, AKR/J, BALB/cJ, NOD/MrkTac
	d	523bp	CAST/EiJ
	e	527bp	SPRET/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit224	a	smaller	129P3/J
	D8Mit224	s	larger	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D8Mit224	a	454bp	A.CA/W, AKR/W, BALB/cW, BN/aW, CBA/W
	b	430bpb	129/SvW
	c	326bp	C3H/W, C57BL/6W, C57BL/10W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24