D1Mit480 Primer Detail MGI Mouse MGI:704635

D1Mit480 Primer Detail

Name

D1Mit480
Primer 1 Sequence

TCATTGTGCCCTAAAACTTGG
Primer 2 Sequence

GAGATGAAGCATTCTCAATTATGC
ID

MGI:704635
Product Size

168
Other IDs

D1Mit480 (BROAD)
Note

MIT assay: MJ5376
Additional information: MIT STS Marker Data Files

D1Mit480

DNA Segment, Chr 1 Massachusetts Institute of Technology 480

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit480	a	158bp	129X1/Sv
Not Specified	D1Mit480	f	154, 162bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit480	a	137bp	CAST/EiJ
	b	154bp	AKR/J
	c	158bp	NOD/MrkTac
	d	160bp	DBA/2J, NON/ShiLt
	e	162bp	A/J, C3H/HeJ, LP/J
	f	170bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	g	186bp	SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit480	c	lower	CBA/Kw
	D1Mit480	e	upper	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24