About   Help   FAQ
D10Mit150 Primer Detail
Primers
  • Name
    D10Mit150
  • Primer 1 Sequence
    CTCACCAAGGGATGTGTGTG
  • Primer 2 Sequence
    TCATTTTCCTTGGCTATATTTGTT
  • ID
    MGI:704646
  • Product Size
    114
  • Other IDs
    D10Mit150 (BROAD)
  • Note
    MIT assay: MT1599
    Additional information: MIT STS Marker Data Files
Genes
D10Mit150 DNA segment, Chr 10, Massachusetts Institute of Technology 150
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit150 a 91bp CAST/EiJ
b 109bp SPRET/EiJ
c 113bp A/J, BALB/cJ
d 115bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
e 117bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
f 121bp DBA/2J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit150 c 137bp CBA/CaOlaHsd
s 132bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory