D15Mit17 Primer Detail MGI Mouse MGI:704667

D15Mit17 Primer Detail

Name

D15Mit17
Primer 1 Sequence

GCGTCACTGATAGTAGGGAG
Primer 2 Sequence

GTACCCCAATCCTGAACCAC
ID

MGI:704667
Product Size

137
Other IDs

D15Mit17 (BROAD)
Note

MIT assay: D22
Additional information: MIT STS Marker Data Files

D15Mit17

DNA segment, Chr 15, Massachusetts Institute of Technology 17

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit17	c	135bp	C3HeB/FeJLe
	D15Mit17	f	larger	FVB/N

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D15Mit17	a	largest	C57BL/6, DBA/2
Not Specified	D15Mit17	b	smaller	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit17	a	135bp	BALB/cJ, C3H/HeJ
	b	138bp	NOD/MrkTac
	c	140bp	CAST/EiJ, NON/ShiLt, SPRET/EiJ
	d	142bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24