About   Help   FAQ
D15Mit16 Primer Detail
Primers
  • Name
    D15Mit16
  • Primer 1 Sequence
    AGACTCAGAGGGCAAAATAAAGC
  • Primer 2 Sequence
    TCGGCTTTTGTCTGTCTGTC
  • ID
    MGI:704668
  • Product Size
    119
  • Other IDs
    D15Mit16 (BROAD)
  • Note
    MIT assay: d131
    Additional information: MIT STS Marker Data Files
Genes
D15Mit16 DNA segment, Chr 15, Massachusetts Institute of Technology 16
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit16 a 124bp 129X1/Sv
f 140bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit16 b smaller than f C57BL/6J
c 122bp C3HeB/FeJLe
f larger FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit16 m 138bp MOLF/EiJ
s 170bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit16 a 122bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
b 124bp A/J, BALB/cJ
c 140bp AKR/J, CAST/EiJ, DBA/2J
d 154bp SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory