D15Mit16 Primer Detail MGI Mouse MGI:704668

D15Mit16 Primer Detail

Name

D15Mit16
Primer 1 Sequence

AGACTCAGAGGGCAAAATAAAGC
Primer 2 Sequence

TCGGCTTTTGTCTGTCTGTC
ID

MGI:704668
Product Size

119
Other IDs

D15Mit16 (BROAD)
Note

MIT assay: d131
Additional information: MIT STS Marker Data Files

D15Mit16

DNA segment, Chr 15, Massachusetts Institute of Technology 16

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D15Mit16	a	124bp	129X1/Sv
Not Specified	D15Mit16	f	140bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D15Mit16	b	smaller than f	C57BL/6J
	c	122bp	C3HeB/FeJLe
	f	larger	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D15Mit16	m	138bp	MOLF/EiJ
Not Specified	D15Mit16	s	170bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit16	a	122bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
	b	124bp	A/J, BALB/cJ
	c	140bp	AKR/J, CAST/EiJ, DBA/2J
	d	154bp	SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24