D15Mit14 Primer Detail MGI Mouse MGI:704670

D15Mit14 Primer Detail

Name

D15Mit14
Primer 1 Sequence

GAGAGGAAAACCATGTCAATCACT
Primer 2 Sequence

TCCTCTTAAACCAAGATCTCTGCT
ID

MGI:704670
Product Size

194
Other IDs

D15Mit14 (BROAD)
Note

MIT assay: D17
Additional information: MIT STS Marker Data Files

D15Mit14

DNA segment, Chr 15, Massachusetts Institute of Technology 14

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit14	c	181bp	C3HeB/FeJLe
	D15Mit14	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit14	a	181bp	A/J, C3H/HeJ
	b	186bp	NON/ShiLt, SPRET/EiJ
	c	188bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	d	192bp	BALB/cJ
	e	227bp	LP/J
	f	270bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D15Mit14	c	193bp	BALB/cJ
	d	189bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
	g	219bp	129P3/J
	j	223bp	JF1
	p	187bp	PWB
	w	183bp	A/JOlaHsd, C3H/HeJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit14	l	larger	LG/J
	D15Mit14	s	smaller	SM/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24