D15Mit18 Primer Detail MGI Mouse MGI:704680

D15Mit18 Primer Detail

Name

D15Mit18
Primer 1 Sequence

GGGCTAATTGATAAATGATTAGTGC
Primer 2 Sequence

CCCAATTCAGGGTTTCTAACC
ID

MGI:704680
Product Size

132
Other IDs

D15Mit18 (BROAD)
Note

MIT assay: A1119
Additional information: MIT STS Marker Data Files

D15Mit18

DNA segment, Chr 15, Massachusetts Institute of Technology 18

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit18	c	138bp	C3HeB/FeJLe
	D15Mit18	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit18	a	134bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	136bp	CAST/EiJ
	c	138bp	C3H/HeJ, DBA/2J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24