D18Mit110 Primer Detail MGI Mouse MGI:704682

D18Mit110 Primer Detail

Name

D18Mit110
Primer 1 Sequence

GGGAGCCGAATTAACACAAA
Primer 2 Sequence

AACCAAAAACCTTCAAGATAAACA
ID

MGI:704682
Product Size

149
Other IDs

D18Mit110 (BROAD)
Note

MIT assay: MT1579
Additional information: MIT STS Marker Data Files

DNA segment, Chr 18, Massachusetts Institute of Technology 110

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit110	a	121bp	A/J, AKR/J
	b	125bp	CAST/EiJ
	c	133bp	BALB/cJ, C3H/HeJ
	d	145bp	SPRET/EiJ
	e	149bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	f	153bp	DBA/2J, LP/J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit110	c	larger	CBA/Kw
	D18Mit110	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24