About   Help   FAQ
D15Mit85 Primer Detail
Primers
  • Name
    D15Mit85
  • Primer 1 Sequence
    AGATTCGGGGATTCCTGACT
  • Primer 2 Sequence
    GCAAATGTGACATGAGTAAGGC
  • ID
    MGI:704754
  • Product Size
    196
  • Other IDs
    D15Mit85 (BROAD)
  • Note
    MIT assay: MPC2136
    Additional information: MIT STS Marker Data Files
Genes
D15Mit85 DNA segment, Chr 15, Massachusetts Institute of Technology 85
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit85 a 179bp A/J
b 189bp CAST/EiJ
c 191bp AKR/J
d 193bp B6.Cg-Lepob/+, BALB/cJ, NON/ShiLt
e 195bp C57BL/6J, LP/J, NOD/MrkTac
f 197bp C3H/HeJ, DBA/2J
g 205bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D15Mit85 a 193bp AKR/OlaHsd
c 197bp BALB/cJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
d 201bp C3H/HeJ, DBA/2J
g 203bp 129P3/J
j 205bp JF1
p 187bp PWB
w 179bp A/JOlaHsd
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D15Mit85 c 119bp CBA/CaOlaHsd
s 132bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory