About   Help   FAQ
D15Mit86 Primer Detail
Primers
  • Name
    D15Mit86
  • Primer 1 Sequence
    TACACTTATCTGTTGGAACATCCC
  • Primer 2 Sequence
    ATATAGATAAACACACGCACACCA
  • ID
    MGI:704756
  • Product Size
    171
  • Other IDs
    D15Mit86 (BROAD)
  • Note
    MIT assay: MPC612
    Additional information: MIT STS Marker Data Files
Genes
D15Mit86 DNA segment, Chr 15, Massachusetts Institute of Technology 86
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit86 a 172bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J
b 178bp AKR/J
c 190bp NON/ShiLt
d 196bp C3H/HeJ, DBA/2J, NOD/MrkTac
e 220bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D15Mit86 a 196bp A.CA/W, C3H/W, DBA/2W
c 188bp BN/aW
d 178bp AKR/W, CBA/W
e 172bp 129/SvW, BALB/cW, C57BL/6W, C57BL/10W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D15Mit86 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory