D15Mit86 Primer Detail MGI Mouse MGI:704756

D15Mit86 Primer Detail

Name

D15Mit86
Primer 1 Sequence

TACACTTATCTGTTGGAACATCCC
Primer 2 Sequence

ATATAGATAAACACACGCACACCA
ID

MGI:704756
Product Size

171
Other IDs

D15Mit86 (BROAD)
Note

MIT assay: MPC612
Additional information: MIT STS Marker Data Files

D15Mit86

DNA segment, Chr 15, Massachusetts Institute of Technology 86

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit86	a	172bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	b	178bp	AKR/J
	c	190bp	NON/ShiLt
	d	196bp	C3H/HeJ, DBA/2J, NOD/MrkTac
	e	220bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D15Mit86	a	196bp	A.CA/W, C3H/W, DBA/2W
	c	188bp	BN/aW
	d	178bp	AKR/W, CBA/W
	e	172bp	129/SvW, BALB/cW, C57BL/6W, C57BL/10W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit86	c	smaller	CBA/Kw
	D15Mit86	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24