D17Mit232 Primer Detail MGI Mouse MGI:704759

D17Mit232 Primer Detail

Name

D17Mit232
Primer 1 Sequence

TAGCAGACTCCGTCAAAAACTAA
Primer 2 Sequence

TTTATTTGTTTTTGTGTTGGTTGG
ID

MGI:704759
Product Size

102
Other IDs

D17Mit232 (BROAD)
Note

MIT assay: MTH1455
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 17, Massachusetts Institute of Technology 232.1

J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit232.1	a	small	C3.SW-H2^b, C3H/HeJ
		b	medium	C57BL/6, C57BL/10
		c	large	B10.CAS3, B10.CAS4

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit232.1	a	82bp	SPRET/EiJ
	b	94bp	AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	c	98bp	CAST/EiJ
	d	102bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt

J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24