About   Help   FAQ
D17Mit232 Primer Detail
Primers
  • Name
    D17Mit232
  • Primer 1 Sequence
    TAGCAGACTCCGTCAAAAACTAA
  • Primer 2 Sequence
    TTTATTTGTTTTTGTGTTGGTTGG
  • ID
    MGI:704759
  • Product Size
    102
  • Other IDs
    D17Mit232 (BROAD)
  • Note
    MIT assay: MTH1455
    Additional information: MIT STS Marker Data Files
Genes
D17Mit232.1 DNA Segment, Chr 17, Massachusetts Institute of Technology 232.1
Polymorphisms
J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit232.1 a small C3.SW-H2b, C3H/HeJ
b medium C57BL/6, C57BL/10
c large B10.CAS3, B10.CAS4
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit232.1 a 82bp SPRET/EiJ
b 94bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
c 98bp CAST/EiJ
d 102bp A/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
References
J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory