About   Help   FAQ
D19Mit63 Primer Detail
Primers
  • Name
    D19Mit63
  • Primer 1 Sequence
    CGCTTTCTTTGACTGGAATG
  • Primer 2 Sequence
    GTCCTTTCACTTTCCACATGTG
  • ID
    MGI:704768
  • Product Size
    150
  • Other IDs
    D19Mit63 (BROAD)
  • Note
    MIT assay: MMH328
    Additional information: MIT STS Marker Data Files
Genes
D19Mit63 DNA segment, Chr 19, Massachusetts Institute of Technology 63
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit63 a 146bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 152bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
c 156bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D19Mit63 a 147bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, SJL/J
d 141bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, DBA/2J
p 151bp JF1, PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory