D4Mit348 Primer Detail MGI Mouse MGI:704785

D4Mit348 Primer Detail

Name

D4Mit348
Primer 1 Sequence

ACCAAACTTGAGTTCTATGTAAGAACA
Primer 2 Sequence

TGCTTACATATCAAAACAATACAGACA
ID

MGI:704785
Product Size

175
Other IDs

D4Mit348 (BROAD)
Note

MIT assay: MTH2785
Additional information: MIT STS Marker Data Files

D4Mit348

DNA Segment, Chr 4, Massachusetts Institute of Technology 348

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit348	a	174bp	LP/J, NON/ShiLt
	b	178bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac
	c	190bp	CAST/EiJ
	d	192bp	A/J, BALB/cJ
	e	194bp	DBA/2J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit348	c	larger	CBA/Kw
	D4Mit348	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24