D2Mit113 Primer Detail MGI Mouse MGI:704794

D2Mit113 Primer Detail

Name

D2Mit113
Primer 1 Sequence

CTCACGTGAGGGTCATGAGA
Primer 2 Sequence

CTTCTCTACCTTCCTCAGAAGCC
ID

MGI:704794
Product Size

147
Other IDs

D2Mit113 (BROAD)
Note

MIT assay: MPC320
Additional information: MIT STS Marker Data Files

D2Mit113

DNA segment, Chr 2, Massachusetts Institute of Technology 113

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit113	m	157bp	MOLF/EiJ
Not Specified	D2Mit113	s	146bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit113	a	128bp	A/J, AKR/J, NON/ShiLt
	b	130bp	CAST/EiJ
	c	132bp	SPRET/EiJ
	d	146bp	BALB/cJ, C3H/HeJ, DBA/2J
	e	148bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24