About   Help   FAQ
D2Mit42 Primer Detail
Primers
  • Name
    D2Mit42
  • Primer 1 Sequence
    ATTACTGGGCAGGAACATTTG
  • Primer 2 Sequence
    GCCAAACTTCCAGACTCCTC
  • ID
    MGI:704798
  • Product Size
    132
  • Other IDs
    D2Mit42 (BROAD)
  • Note
    MIT assay: A695
    Additional information: MIT STS Marker Data Files
Genes
D2Mit42 DNA segment, Chr 2, Massachusetts Institute of Technology 42
Polymorphisms
J:38532 Steelman S, et al., Genome Res. 1997 Feb;7(2):142-56
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit42 a 136bp AEJ/Gn-a Gdf5bp-H
s 112bp M. spretus
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D2Mit42 b larger than f C57BL/6J
c 142bp C3HeB/FeJLe
f smaller than c and b FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit42 a 112bp SPRET/EiJ
b 124bp NON/ShiLt
c 128bp NOD/MrkTac
d 130bp CAST/EiJ
e 136bp B6.Cg-Lepob/+, C57BL/6J
f 142bp C3H/HeJ
g 150bp A/J, AKR/J, BALB/cJ, DBA/2J, LP/J
References
J:38532 Steelman S, et al., Identification of a conserved family of Meis1-related homeobox genes [letter]. Genome Res. 1997 Feb;7(2):142-56
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory