D2Mit42 Primer Detail MGI Mouse MGI:704798

D2Mit42 Primer Detail

Name

D2Mit42
Primer 1 Sequence

ATTACTGGGCAGGAACATTTG
Primer 2 Sequence

GCCAAACTTCCAGACTCCTC
ID

MGI:704798
Product Size

132
Other IDs

D2Mit42 (BROAD)
Note

MIT assay: A695
Additional information: MIT STS Marker Data Files

D2Mit42

DNA segment, Chr 2, Massachusetts Institute of Technology 42

J:38532 Steelman S, et al., Genome Res. 1997 Feb;7(2):142-56

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit42	a	136bp	AEJ/Gn-a Gdf5^bp-H
Not Specified	D2Mit42	s	112bp	M. spretus

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D2Mit42	b	larger than f	C57BL/6J
	c	142bp	C3HeB/FeJLe
	f	smaller than c and b	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit42	a	112bp	SPRET/EiJ
	b	124bp	NON/ShiLt
	c	128bp	NOD/MrkTac
	d	130bp	CAST/EiJ
	e	136bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	142bp	C3H/HeJ
	g	150bp	A/J, AKR/J, BALB/cJ, DBA/2J, LP/J

J:38532 Steelman S, et al., Identification of a conserved family of Meis1-related homeobox genes [letter]. Genome Res. 1997 Feb;7(2):142-56

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24