About   Help   FAQ
D1Mit206 Primer Detail
Primers
  • Name
    D1Mit206
  • Primer 1 Sequence
    TGAGGCACCTTTGTATTCAGC
  • Primer 2 Sequence
    CCAGATGTCTTTGAACATTCTCC
  • ID
    MGI:704799
  • Product Size
    126
  • Other IDs
    D1Mit206 (BROAD)
  • Note
    MIT assay: MT820
    Additional information: MIT STS Marker Data Files
Genes
D1Mit206 DNA segment, Chr 1, Massachusetts Institute of Technology 206
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit206 a 114bp AKR/J, CAST/EiJ, DBA/2J, NON/ShiLt
b 116bp A/J
c 118bp BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
d 123bp C57BL/6J
e 126bp B6.Cg-Lepob/+
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D1Mit206 b 127bp C57BL/6JOlaHsd
c 119bp 129P3/J, BALB/cJ, SJL/J
d 115bp AKR/OlaHsd, DBA/2J
h 109bp C3H/HeJ
j 123bp JF1
p 117bp A/JOlaHsd, PWB
r 121bp C57BL/10
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/09/2024
MGI 6.24
The Jackson Laboratory