About   Help   FAQ
D18Mit149 Primer Detail
Primers
  • Name
    D18Mit149
  • Primer 1 Sequence
    CCTAGATGCATGACTCAGTTTACTC
  • Primer 2 Sequence
    TTGCTGAGAACCAGAGAATGG
  • ID
    MGI:704808
  • Product Size
    136
  • Other IDs
    D18Mit149 (BROAD)
  • Note
    MIT assay: MT1983
    Additional information: MIT STS Marker Data Files
Genes
D18Mit149 DNA segment, Chr 18, Massachusetts Institute of Technology 149
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit149 a 114bp A/J, AKR/J
b 116bp BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
c 118bp LP/J, NON/ShiLt
d 124bp CAST/EiJ
e 132bp SPRET/EiJ
f 136bp B6.Cg-Lepob/+, C57BL/6J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D18Mit149 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D18Mit149 c 132bp CBA/CaOlaHsd
s 129bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory