About   Help   FAQ
D2Mit15 Primer Detail
Primers
  • Name
    D2Mit15
  • Primer 1 Sequence
    ATGCCTTAGAAGAATTTGTTCCC
  • Primer 2 Sequence
    CTTGAAAAACACATCAAAATCTGC
  • ID
    MGI:704831
  • Product Size
    142
  • Other IDs
    D2Mit15 (BROAD)
  • Note
    MIT assay: A61
    Additional information: MIT STS Marker Data Files
  • Synonyms
    A61
Genes
D2Mit15 DNA segment, Chr 2, Massachusetts Institute of Technology 15
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D2Mit15 a 162bp A/J
e 145bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
f 178bp CAST/EiJ
s 160bp AKR/J, C3H/HeJ, SPRET/EiJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit15 a 142bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 156bp AKR/J, C3H/HeJ, SPRET/EiJ
c 158bp A/J
d 175bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D2Mit15 a 160bp 129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W
b 145bp BALB/cW, C57BL/6W, C57BL/10W, DBA/2W
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory