D2Mit15 Primer Detail MGI Mouse MGI:704831

D2Mit15 Primer Detail

Name

D2Mit15
Primer 1 Sequence

ATGCCTTAGAAGAATTTGTTCCC
Primer 2 Sequence

CTTGAAAAACACATCAAAATCTGC
ID

MGI:704831
Product Size

142
Other IDs

D2Mit15 (BROAD)
Note

MIT assay: A61
Additional information: MIT STS Marker Data Files
Synonyms

A61

D2Mit15

DNA segment, Chr 2, Massachusetts Institute of Technology 15

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D2Mit15	a	162bp	A/J
	e	145bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	f	178bp	CAST/EiJ
	s	160bp	AKR/J, C3H/HeJ, SPRET/EiJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit15	a	142bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	156bp	AKR/J, C3H/HeJ, SPRET/EiJ
	c	158bp	A/J
	d	175bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit15	a	160bp	129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W
	D2Mit15	b	145bp	BALB/cW, C57BL/6W, C57BL/10W, DBA/2W

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24