D8Mit215 Primer Detail MGI Mouse MGI:704862

D8Mit215 Primer Detail

Name

D8Mit215
Primer 1 Sequence

AATACACAAGGTTGGCCTCA
Primer 2 Sequence

ATGTGTGGATATTCATGTGCTC
ID

MGI:704862
Product Size

178
Other IDs

D8Mit215 (BROAD)
Note

MIT assay: MT3325
Additional information: MIT STS Marker Data Files

D8Mit215

DNA segment, Chr 8, Massachusetts Institute of Technology 215

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit215	a	184bp	129X1/Sv
Not Specified	D8Mit215	f	164bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D8Mit215	b	largest	C57BL/6J
	c	164bp	C3HeB/FeJLe
	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit215	a	162bp	CAST/EiJ
	b	164bp	C3H/HeJ
	c	168bp	SPRET/EiJ
	d	176bp	DBA/2J
	e	182bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	f	184bp	AKR/J, BALB/cJ, LP/J, NOD/MrkTac

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D8Mit215	c	larger	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit215	c	159bp	CBA/CaOlaHsd
	D8Mit215	s	177bp	SWR/OlaHsd

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit215	c	upper	CBA/Kw
	D8Mit215	e	lower	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13