D5Mit222 Primer Detail MGI Mouse MGI:704872

D5Mit222 Primer Detail

Name

D5Mit222
Primer 1 Sequence

TGTGTTAAAGATGCTCTGGGG
Primer 2 Sequence

TGGTAGACTAATTACCTAGCATGTGC
ID

MGI:704872
Product Size

108
Other IDs

D5Mit222 (BROAD)
Note

MIT assay: MT2195
Additional information: MIT STS Marker Data Files

D5Mit222

DNA segment, Chr 5, Massachusetts Institute of Technology 222

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit222	a	89bp	129X1/Sv
Not Specified	D5Mit222	f	89, 104bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit222	a	87bp	SPRET/EiJ
	b	89bp	AKR/J, DBA/2J, LP/J
	c	104bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	115bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24