D5Mit221 Primer Detail MGI Mouse MGI:704873

D5Mit221 Primer Detail

Name

D5Mit221
Primer 1 Sequence

TAGGAGGTCTTGTTTTGTTTTCTG
Primer 2 Sequence

CACACGGAGAAGGGAGAAAA
ID

MGI:704873
Product Size

148
Other IDs

D5Mit221 (BROAD)
Note

MIT assay: MT2452
Additional information: MIT STS Marker Data Files

D5Mit221

DNA segment, Chr 5, Massachusetts Institute of Technology 221

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit221	a	133bp	129X1/Sv
Not Specified	D5Mit221	f	123, 133bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit221	a	128bp	CAST/EiJ
	b	129bp	B6.Cg-Lep^ob/+
	c	151bp	C57BL/6J
	d	153bp	A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	e	155bp	BALB/cJ
	f	157bp	SPRET/EiJ
	g	159bp	AKR/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit221	c	152bp	CBA/CaOlaHsd
	D5Mit221	s	160bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24