D12Mit285 Primer Detail MGI Mouse MGI:704879

D12Mit285 Primer Detail

Name

D12Mit285
Primer 1 Sequence

GCCTCTTTCTAAATTTTTATGTTGTT
Primer 2 Sequence

GTCTGTCTGTCTGTCTTTTTCACA
ID

MGI:704879
Product Size

125
Other IDs

D12Mit285 (BROAD)
Note

MIT assay: MTH2782
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 12, Massachusetts Institute of Technology 285

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit285	a	115bp	CAST/EiJ
	b	123bp	NON/ShiLt
	c	127bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	d	139bp	BALB/cJ
	e	141bp	AKR/J
	f	143bp	A/J, C3H/HeJ, NOD/MrkTac
	g	147bp	DBA/2J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit285	c	larger	CBA/Kw
	D12Mit285	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24