D8Mit11 Primer Detail MGI Mouse MGI:704911

D8Mit11 Primer Detail

Name

D8Mit11
Primer 1 Sequence

GCAGCAGTGGTAGCAAATAGC
Primer 2 Sequence

CTTAATCAGCAATCCTTGACACC
ID

MGI:704911
Product Size

217
Other IDs

D8Mit11 (BROAD)
Note

MIT assay: A105
Additional information: MIT STS Marker Data Files

D8Mit11

DNA segment, Chr 8, Massachusetts Institute of Technology 11

J:38923 Becker-Follmann J, et al., Mamm Genome. 1997 Mar;8(3):172-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit11	d	0.195kb	DS8, M. spretus
Not Specified	D8Mit11	m	0.196kb	M. m. molossinus

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit11	a	191bp	SPRET/EiJ
	b	197bp	CAST/EiJ
	c	209bp	C3H/HeJ, DBA/2J, NOD/MrkTac
	d	210bp	NON/ShiLt
	e	211bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	f	212bp	BALB/cJ

J:38923 Becker-Follmann J, et al., High-resolution mapping of a linkage group on mouse chromosome 8 conserved on human chromosome 16Q. Mamm Genome. 1997 Mar;8(3):172-7

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24