D8Mit16 Primer Detail MGI Mouse MGI:704912

D8Mit16 Primer Detail

Name

D8Mit16
Primer 1 Sequence

GCCTGGATTTCCTCATTGAA
Primer 2 Sequence

AGTTGGTTATCCCTGAAAATATACA
ID

MGI:704912
Product Size

300
Other IDs

D8Mit16 (BROAD)
Note

MIT assay: D100
Additional information: MIT STS Marker Data Files

D8Mit16

DNA segment, Chr 8, Massachusetts Institute of Technology 16

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit16	c	298bp	C3HeB/FeJLe
	D8Mit16	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit16	a	298bp	AKR/J, C3H/HeJ, LP/J
	b	300bp	A/J, DBA/2J
	c	309bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	315bp	CAST/EiJ
	e	320bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24