About   Help   FAQ
D8Mit15 Primer Detail
Primers
  • Name
    D8Mit15
  • Primer 1 Sequence
    AGCTGAATTTGAGCTAGTCG
  • Primer 2 Sequence
    AAGCTTACGGTTTAATCCCC
  • ID
    MGI:704915
  • Product Size
    180
  • Other IDs
    D8Mit15 (BROAD)
  • Note
    MIT assay: D20
    Additional information: MIT STS Marker Data Files
Genes
D8Mit15 DNA segment, Chr 8, Massachusetts Institute of Technology 15
Polymorphisms
J:38923 Becker-Follmann J, et al., Mamm Genome. 1997 Mar;8(3):172-7
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit15 d 0.160kb DS8, M. spretus
m 0.148kb M. m. molossinus
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit15 m 190bp MOLF/EiJ
s 182bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit15 a 158bp SPRET/EiJ
b 175bp AKR/J, LP/J
c 177bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
d 182bp NOD/MrkTac
e 183bp CAST/EiJ
References
J:38923 Becker-Follmann J, et al., High-resolution mapping of a linkage group on mouse chromosome 8 conserved on human chromosome 16Q. Mamm Genome. 1997 Mar;8(3):172-7
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory