D8Mit248 Primer Detail MGI Mouse MGI:704916

D8Mit248 Primer Detail

Name

D8Mit248
Primer 1 Sequence

ATCCCTCAAGCAGTACCCCT
Primer 2 Sequence

AGCAGAGGACCACACCTTACA
ID

MGI:704916
Product Size

148
Other IDs

D8Mit248 (BROAD)
Note

MIT assay: MT2828
Additional information: MIT STS Marker Data Files

D8Mit248

DNA segment, Chr 8, Massachusetts Institute of Technology 248

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit248	a	110bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	106bp	129X1/SvJ
		c	110, 118bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit248	c	154bp	C3HeB/FeJLe
	D8Mit248	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit248	a	108bp	BALB/cJ
	b	110bp	DBA/2J
	c	112bp	NOD/MrkTac
	d	118bp	AKR/J
	e	120bp	LP/J, NON/ShiLt
	f	146bp	CAST/EiJ
	g	154bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	h	164bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit248	c	142bp	CBA/CaOlaHsd
	D8Mit248	s	155bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24