D7Mit20 Primer Detail MGI Mouse MGI:704957

D7Mit20 Primer Detail

Name

D7Mit20
Primer 1 Sequence

GTGTAGCAATGGTGTCGGTG
Primer 2 Sequence

AAGCCTGCCTCCAGATGTAA
ID

MGI:704957
Product Size

93
Note

MIT assay: d103

D7Mit20

DNA segment, Chr 7, Massachusetts Institute of Technology 20

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit20	m	106bp	MOLF/EiJ
Not Specified	D7Mit20	s	absent	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit20	a	79bp	SPRET/EiJ
	b	94bp	NOD/MrkTac
	c	99bp	CAST/EiJ
	d	106bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24