About   Help   FAQ
D12Mit28 Primer Detail
Primers
  • Name
    D12Mit28
  • Primer 1 Sequence
    TTGGCAGTCCAGAGGAGGT
  • Primer 2 Sequence
    CCAGTTCTGGTGTCAGTTTTACC
  • ID
    MGI:704959
  • Product Size
    142
  • Other IDs
    D12Mit28 (BROAD)
  • Note
    MIT assay: A752
    Additional information: MIT STS Marker Data Files
Genes
D12Mit28 DNA segment, Chr 12, Massachusetts Institute of Technology 28
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit28 a 122bp CAST/EiJ, SPRET/EiJ
b 144bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
c 146bp LP/J
d 148bp NON/ShiLt
e 152bp BALB/cJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit28 c 126bp CBA/CaOlaHsd
s 102bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory