D1Mit452 Primer Detail MGI Mouse MGI:704985

D1Mit452 Primer Detail

Name

D1Mit452
Primer 1 Sequence

ACACATCTATATCACTGCCCCC
Primer 2 Sequence

ATCTCATTCCTGAGCCTTATGTG
ID

MGI:704985
Product Size

98
Other IDs

D1Mit452 (BROAD)
Note

MIT assay: MTH589
Additional information: MIT STS Marker Data Files

D1Mit452

DNA Segment, Chr 1, Massachusetts Institute of Technology 452

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit452	a	74bp	CAST/EiJ
	b	92bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	c	98bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	d	104bp	DBA/2J, NON/ShiLt
	e	108bp	SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit452	c	lower	CBA/Kw
	D1Mit452	e	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24