About   Help   FAQ
D17Mit18 Primer Detail
Primers
  • Name
    D17Mit18
  • Primer 1 Sequence
    GCAGCTCATTCTTAGTCCCTAAT
  • Primer 2 Sequence
    TCATGAGTCCCCAAACTAGC
  • ID
    MGI:704990
  • Product Size
    250
  • Note
    MIT assay: M33
Genes
D17Mit18 DNA segment, Chr 17, Massachusetts Institute of Technology 18
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit18 a 241bp 129X1/Sv
f 237, 241, 246bp CD-1
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit18 b 246bp C57BL/6J
c 241bp BALB/cJ
s 251bp 129X1/SvJ
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit18 m 256bp MOLF/EiJ
s absent 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit18 a 238bp SPRET/EiJ
b 241bp BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
c 242bp A/J
d 246bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J
e 256bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory