D17Mit11 Primer Detail MGI Mouse MGI:704994

D17Mit11 Primer Detail

Name

D17Mit11
Primer 1 Sequence

TGAATTTATGAGGGGGGTCA
Primer 2 Sequence

TGTCCCATATCTCTCTTTATACACA
ID

MGI:704994
Product Size

171
Note

MIT assay: M145

D17Mit11

DNA segment, Chr 17, Massachusetts Institute of Technology 11

J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit11	a	small	B10.CAS3
		b	medium	B10.CAS4, C3.SW-H2^b
		c	large	C3H/HeJ, C57BL/6, C57BL/10

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit11	a	largest	C57BL/6, MSM/Ms
Not Specified	D17Mit11	b	smaller	DBA/2, JF1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit11	a	150bp	BALB/cJ, DBA/2J, NON/ShiLt
	b	160bp	A/J, LP/J
	c	176bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	d	178bp	NOD/MrkTac, SPRET/EiJ
	e	192bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit11	l	smaller	LG/J
	D17Mit11	s	larger	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit11	c	143bp	CBA/CaOlaHsd
	D17Mit11	s	126bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit11	a	176bp	AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	b	160bp	129/SvW, BN/aW
	c	150bp	A.CA/W, BALB/cW, DBA/2W

J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24