D17Mit13 Primer Detail MGI Mouse MGI:704996

D17Mit13 Primer Detail

Name

D17Mit13
Primer 1 Sequence

GATCCAGACCACACCCCCTCACCA
Primer 2 Sequence

TCCTTTGAGAGCCAAGCTTGAAGG
ID

MGI:704996
Product Size

48
Other IDs

D17Mit13 (BROAD)
Note

MIT assay: l57
Additional information: MIT STS Marker Data Files

D17Mit13

DNA segment, Chr 17, Massachusetts Institute of Technology 13

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit13	a	smallest	M. caroli, P/J
		b	larger	RIIIS/J
		c	larger than above	SWR/J
		d	larger than above	A.CA-H2^f/Sn, CBA/J, SM/J
		e	larger than above	CAST/EiJ, DBA/2J
		f	larger than above	M. spretus
		g	larger than above	C57BL/6J
		h	larger than above	SJL/J

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit13	c	142bp	BALB/cJ
Not Specified	D17Mit13	s	147bp	129X1/SvJ, C57BL/6J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit13	a	140bp	AKR/J, C3H/HeJ
	b	142bp	A/J, BALB/cJ, CAST/EiJ, DBA/2J
	c	144bp	SPRET/EiJ
	d	147bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit13	l	larger	LG/J
	D17Mit13	s	smaller	SM/J

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24