D11Mit224 Primer Detail MGI Mouse MGI:705005

D11Mit224 Primer Detail

Name

D11Mit224
Primer 1 Sequence

CTCATCATGGAAGGAGAGAACC
Primer 2 Sequence

TCAACTATAATAATTTCTCCAACCTCA
ID

MGI:705005
Product Size

150
Other IDs

D11Mit224 (BROAD)
Note

MIT assay: MT3391
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 224

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit224	a	148bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	b	158bp	A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	162bp	BALB/cJ, SPRET/EiJ
	d	170bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D11Mit224	a	144bp	AKR/OlaHsd
	b	146bp	C57BL/6JOlaHsd, C57BL/10, SJL/J
	c	164bp	BALB/cJ
	d	160bp	129P3/J, A/JOlaHsd, C3H/HeJ, DBA/2J
	j	186bp	JF1
	p	178bp	PWB

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit224	l	smaller	LG/J
	D11Mit224	s	larger	SM/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24