D11Mit227 Primer Detail MGI Mouse MGI:705006

D11Mit227 Primer Detail

Name

D11Mit227
Primer 1 Sequence

CCAGCATTTGAACCCTGATT
Primer 2 Sequence

AAACCCATAGCCTGCATCTG
ID

MGI:705006
Product Size

167
Other IDs

D11Mit227 (BROAD)
Note

MIT assay: MT3870
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 227

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit227	c	166bp	C3HeB/FeJLe
	D11Mit227	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit227	a	116bp	CAST/EiJ
	b	120bp	SPRET/EiJ
	c	166bp	AKR/J, C3H/HeJ, DBA/2J
	d	170bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	e	178bp	LP/J
	f	182bp	A/J
	g	188bp	BALB/cJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit227	c	124bp	CBA/CaOlaHsd
	D11Mit227	s	119bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24