D9Mit135 Primer Detail MGI Mouse MGI:705021

D9Mit135 Primer Detail

Name

D9Mit135
Primer 1 Sequence

AGGAAAGAGCCAACTCCCAT
Primer 2 Sequence

TTTCCTCTCCTTTTTGCGTA
ID

MGI:705021
Product Size

138
Other IDs

D9Mit135 (BROAD)
Note

MIT assay: MT857
Additional information: MIT STS Marker Data Files

D9Mit135

DNA segment, Chr 9, Massachusetts Institute of Technology 135

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit135	a	119bp	AKR/J, NOD/MrkTac
	b	125bp	CAST/EiJ, DBA/2J, SPRET/EiJ
	c	139bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	d	147bp	A/J, BALB/cJ, C3H/HeJ, LP/J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit135	c	lower	CBA/Kw
	D9Mit135	e	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24