D3Mit305 Primer Detail MGI Mouse MGI:705028

D3Mit305 Primer Detail

Name

D3Mit305
Primer 1 Sequence

GAATCTAACTTGGGGACCTGC
Primer 2 Sequence

TACAGAAAGGTGATTGGAGTTGG
ID

MGI:705028
Product Size

108
Other IDs

D3Mit305 (BROAD)
Note

MIT assay: MTH2000
Additional information: MIT STS Marker Data Files

D3Mit305

DNA Segment, Chr 3, Massachusetts Institute of Technology 305

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit305	a	108bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	b	112bp	DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	136bp	AKR/J, C3H/HeJ, CAST/EiJ

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit305	b	lower	C57BL/6J
	D3Mit305	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24