About   Help   FAQ
D1Mit58 Primer Detail
Primers
  • Name
    D1Mit58
  • Primer 1 Sequence
    GGACTGGCAATCCTCTTGTC
  • Primer 2 Sequence
    GCACGTTAGAGAGTGGGCTC
  • ID
    MGI:705073
  • Product Size
    254
  • Other IDs
    D1Mit58 (BROAD)
  • Note
    MIT assay: B542
    Additional information: MIT STS Marker Data Files
Genes
D1Mit58 DNA segment, Chr 1, Massachusetts Institute of Technology 58
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit58 a >0.274kb BALB/cByJ
b 0.260kb B10.BR-H2k, B10.D2-H2d, C57BL/6
c 0.274kb BALB.K-H2k, BALB/c, BALB/cAnNCr
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit58 a 260bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
b 268bp A/J
c 270bp AKR/J, LP/J
d 274bp BALB/cJ, NON/ShiLt
e 278bp NOD/MrkTac
f 340bp CAST/EiJ
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory