About   Help   FAQ
D3Mit87 Primer Detail
Primers
  • Name
    D3Mit87
  • Primer 1 Sequence
    TTTGTGTGGCAATGGCTG
  • Primer 2 Sequence
    TATCCTAAACCAGAAGGTGGTTG
  • ID
    MGI:705075
  • Product Size
    131
  • Other IDs
    D3Mit87 (BROAD)
  • Note
    MIT assay: MPC698
    Additional information: MIT STS Marker Data Files
Genes
D3Mit87 DNA segment, Chr 3, Massachusetts Institute of Technology 87
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit87 a 130bp AKR/J, LP/J
b 132bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
c 136bp A/J, BALB/cJ, C3H/HeJ, CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D3Mit87 c 135bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 131bp C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
j 143bp JF1
p 129bp 129P3/J, AKR/OlaHsd, PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory