D17Mit123 Primer Detail MGI Mouse MGI:705091

D17Mit123 Primer Detail

Name

D17Mit123
Primer 1 Sequence

CACAAGGAGGGAGCCTGTAG
Primer 2 Sequence

CACCGTAAGAGTCTAATAATAAGGGG
ID

MGI:705091
Product Size

133
Other IDs

D17Mit123 (BROAD)
Note

MIT assay: MT547
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 123

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit123	a	155bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	149bp	129X1/SvJ
		c	133, 155bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit123	a	133bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	b	137bp	A/J, BALB/cJ
	c	155bp	AKR/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
	d	165bp	CAST/EiJ
	e	181bp	SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D17Mit123	c	smaller	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D17Mit123	b	134bp	C57BL/6JOlaHsd, C57BL/10
	c	140bp	A/JOlaHsd, BALB/cJ
	d	154bp	129P3/J, AKR/OlaHsd, C3H/HeJ, DBA/2J
	l	150bp	SJL/J
	p	162bp	JF1, PWB

J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit123	b	smaller	C57BL/6J
	D17Mit123	l	larger	C57L/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit123	c	152bp	CBA/CaOlaHsd
	D17Mit123	s	147bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit123	a	155bp	129/SvW, AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W
	b	137bp	C57BL/10W
	c	133bp	A.CA/W, BALB/cW, C57BL/6W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24